Клячка ластик: Цена на Ластик-клячка KOH-I-NOOR в пластиковом футляре в Москве — купить в художественном магазине Красный Карандаш


15.06.1972 Facebook Twitter LinkedIn Google+ Разное


Содержание

Клячка — незаменимый инструмент для художника

Для людей, которые связаны с рисованием – ластик просто необходимый инструмент. Им всегда можно исправить или чуть подправить неточности наброска рисунка. Ну что об этом много говорить, если вы и сами хорошо представляете значение ластика для рисующего человека. Вы, наверное, уже слышали, о таком ластике как клячка. Ну а если нет, то давайте посмотрим, что же такое ластик клячка.

Клячка на прокачку

Стоит ли говорит о том, что клячка – это канцелярская принадлежность? Вы уже наверняка это поняли. И то, что она служит для коррекции рисунка, осветления и удаления с него загрязнений, тоже, я думаю, уже догадались.

Это такой же ластик, как и много других ластиков, помогающих художнику в рисовании, который называется – ластик клячка. Отличает клячку от других ластиков, мягкая тестообразная текстура.

Ластик клячка – это специальная очищающая резина, которая легко мнется и имеет высокие абсорбирующие свойства.

При коррекции рисунка ластиком, клячка не повреждает бумагу, а захватывает частички графита, не размазывая при этом рисунок.

Клячку изобрела чешская компания «Koh-i-Noor» — крупнейший производитель материалов для рисования.

Кроме того, что клячка не портит бумагу, от нее еще можно «отщипать» кусочки для стирания ювелирной точности. Можно и не «щипать» клячку, а просто пальцами заострить ее под нужную ширину стирания. Это очень удобно, ведь многие художники режут обычные ластики на маленькие полоски для того, чтобы стирать тонкие линии.

Ластик клячка способна собирать на себя пыль, и поэтому, ее желательно хранить завёрнутой в целлофан или подобный материал. Из-за пыли клячка может выйти из строя очень быстро. Но если пыль, все-таки налипнет на нее, то можно или аккуратно срезать верхний слой, или помять ее как кусочек теста. Тогда, клячка снова будет в строю.

Кстати, клячки делают и самостоятельно, из обычных серых ластиков. Их замачивают в очищенном бензине на два-три дня, а затем, после того как резинка разбухнет, кладут на бумажное полотенце для удаления бензина.

После высыхания, ластик нужно прокипятить и он станет пригодным для рисования в качестве клячки.

Ластик клячка из формопласта

В магазинах встречаются клячки из формопласта. Они такие же липкие и способны собирать на себя кусочки графита. Но отличие их от обычной клячки в том, что они не могут менять форму. По сути, ластик клячка из формопласта — это куски мягкого пластика. Клячки из формопласта более долговечны, и их можно мыть водой.

Стоит помнить, что материал формопласт способен разъедать пластмассы – корпусы телефонов, пеналы и т.д. Хранить его нужно обязательно в бумаге, чтобы клячка из формопласта не прикасалась к пластмассовым поверхностям.

Также интересные статьи о свойствах карандашей «Наброски карандашом – а каким лучше?» и «Бумага для рисования: основные типы и особенности»

 

Ластик, клячка и другие — Это Лео! — ЖЖ

Для художника и любого другого человека, что имеет дело с рисованием/черчением карандашами и мягкими материалами, ластик — штука крайне полезная и необходимая. Этот пост будет о моих резинках и личных впечатлениях о них.
Во главе парада идет ластик-клячка — очень удобная резинка: не крошится, не портит бумагу, можно смять в стирающую поверхность любой длинны и толщины. Обычно, режу резинку на три части, потому что всю использовать нет смысла — большая и не удобно. Единственный минус — не стирает очень глубокий штрих, потому что на нее нельзя надавить, не хватает жесткости. 
Слева Koh-i-Noor в коробочке (молодцы производители! Единственные догадались продавать в коробочке мягкую резинку, которая собирает всю пыль и любой мелкий мусор там, где лежит). 
Серая резинка, кажется, Cretacolor, где-то обертка порвалась и потерялась (а вот если бы была в коробочке!).
Faber Castell догадались делать резинки цветными, что куда приятнее, чем стандартный мерзко-серый цвет, на котором даже загрязнение не видно. 
Розовую резинку совесть не повернулась себе оставить, когда loki1101 просто спать не сможет, если она останется у меня. Пришлось подарить =)  

Недавно приобретенный батареечный девайс с резинкой. Если нажать и удерживать кнопку, резинка крутится и стирает. 
Сразу взяли набор «патронов», ибо часто случается, что такие штуки из продажи пропадают и расходные материалы к ним — тоже. 

Тонкие детали не протрешь, но очень удобно для удаления глубоких штрихов.

Faber Castell в своем репертуаре: круто, удобно, качественно.
Подходит для любых карандашей, а с их родными — смотрится просто великолепно! 
Карандаш в пупырышки, резинка в ямочки =)

И, конечно же, кох-и-норовские «слоники» — знакомы абсолютно всем, привычны и предсказуемы.
Еще в художке нас учили их резать по диагонали, чтобы стирать тонким кончиком, а не «бревном».

А вот с кнопочной резинкой Koh-i-Noor явно дал маху… Предельно бесполезная штука: резинка очень мягкая (гнется), очень пачкается, толстая, мажет.
Исключительно для детей, чтоб поиграть или мазохистов…

Еще один интересный вид резинок — резинка-карандаш. Этот вид резинок удобен в использовании для мелких деталей: сделать маленький блик, придать объема волосам, добавить небольшие светлые пятна в пейзаж, в общем, каждый найдет для себя где и в чем их можно применить.
«Faber Castell» выпускает два вида: 
— мягкая (без кисточки)
— твердая (с кисточкой)

Вот так «рисует». Контраст не сильно заметен, ибо карандаш был 2Н

Еще недавно у нас появились в продаже резинки-карандаши «STAEDTLER». Очень нравятся акварельные карандаши этой фирмы, но это тема отдельного поста. Резинка-карандаш вот такая (качеством похожа на твердую «Faber Castell»)

P.S. Обновлен пост о простых карандашах — набор DALER ROWNEY. 
Бумага для рисования

Что такое клячка и как ее использовать?

Если вы начинающий художник, который только знакомится с миром искусства и изучает материалы для рисования, то могли не слышать о клячке. За этим забавным названием скрывается ластик с интересными свойствами, напоминающий на ощупь пластилин. Давайте разберемся, что это такое — клячка для рисования, и для чего она нужна художнику. Эти знания обязательно пригодятся вам при создании работ карандашом, углем и пастелью. Можете посмотреть, что это — клячка для рисования, на фото ниже.

Мягкий ластик — незаменимая вещь для передачи полутонов и бликов. В отличие от привычных со школьных времен виниловых или резиновых, он гибкий, легко растягивается и сжимается. Клячка меняет форму, как пластилин. Некоторые художники даже используют ее не по назначению и создают фигурки и целые скульптуры, которыми украшают рабочий стол.

Ластик используют и для развлечения. Если скатать массу в шар и бросить его на пол, он подпрыгнет, как мячик. Хотя за пару таких отскоков клячка соберет всю пыль и грязь. Потому вместо смеха вам захочется заняться уборкой. Но лучше заранее уяснить, что клячка для рисования — это не игрушка, а важный инструмент художника. Потому желательно все же использовать ее по назначению. А для игр выбрать что-то другое.

Что нужно знать о клячке перед ее использованием

Клячка способна образовать световой баланс, стремительно набирающий тень либо, наоборот, создать рассеянный блеклый оттенок предмета. Такой ластик уберет ненужные штрихи с рисунка и сделает плавный переход светотени. Ластик имеет удобную, с точки зрения использования, структуру. Физические свойства дают возможность разделять клячку, доводить до определенной эластичности, использовать в разных формах. В зависимости от производителя клячка может иметь разную расцветку, но это никак не отражается на ее свойствах. Выбор такого ластика очень важен для создания художественного грамотного рисунка.

Клячка в рабочем состоянии

Клячка-ластик имеет массу преимуществ:

  • Не повреждает поверхность бумаги;
  • Не делает размытым изображение;
  • Способность не только исправлять ошибки, но создавать блики и полутона;
  • Вязкая структура позволяет разделять клячку на мелкие части для предельно точной корректировки рисунка.

Недостатки:

  • Клячку необходимо хранить в целлофановой упаковке, в открытом виде она собирает на себя пыль;
  • Не хватает жесткости при глубоких темных штрихах.

Для того, чтобы начать работу с клячкой, необходимо ее тщательно размять пальцами. Она используется для рисунка пастельными мелками, сангиной, художественным углем. Стоит заметить, что в работе с графическим мягким материалом, она способна приобретать серую поверхность отпечатывающегося рисунка. В таком случае, необходимо просто еще раз размять клячку, спрятав в середину темную сторону.

Как пользоваться клячкой для рисования

Эти необычные ластики применяют для удаления и выделения таких материалов, как графит, уголь, пастель и мел. Главная особенность клячки для рисования — то, что это пластичный ластик.

Вы можете придать ей любую форму, которая отлично подходит для детализации работы. Если отделить маленький кусочек от остальной массы, заострить его край, как у карандаша, и нанести несколько тонких штрихов, легко исправить небольшой недостаток работы, не стирая лишнего. С обычными резиновыми ластиками совершить такой маневр, не задев большую часть рисунка, проблематично.

Еще одна особенность клячки для рисования — что эта масса не оставляет следов на бумаге. Она будто бы съедает графит или пастель, втягивая их в себя. Работая с клячкой, не нужно постоянно смахивать с работы кусочки грязного ластика. Достаточно просто прижать ее к нужному участку несколько раз — и лишний графит исчезнет.

Но это может не сработать, если следы от карандаша слишком темные и вы рисовали, сильно нажимая на него. Метод «нажми и подними» подходит для большей части работ клячкой. Но при рисовании портрета, когда дело доходит до создания волос, больше подходит вариант с острым кончиком.

Главное — смахнуть графит легкими мазками, не слишком надавливая на рисунок, иначе клячка согнется.

Как убрать ступень темного тона при помощи клячки

Бывает так, что баланс теней выглядит чересчур насыщенным. Используя клячку, избавиться от нескольких слоев темного тона не составит труда. Необходимо размять ее до мягкого состояния и несколько раз придавить клячку к затемненной области. Повторять можно столько раз, сколько этого требует рисунок.

Как сделать блики на рисунке клячкой

Легко мнущийся материал с липкой структурой позволяет делать на художественном рисунке блики на волосах, предметах, блики на стекле и т.д. Блик – это самая освещенная часть предмета.

Блики от работы клячкой

Создавая блик на геометрической фигуре, самая освещенная часть не требует штрихов и светотени. Но все, что исходит дальше, постепенно или густо имеет теневую поэтапность. Вот здесь клячка выступает в роли материала, создающего блики. В зависимости от густоты светотени клячку необходимо прижимать по форме блика, каждый раз разминая ее, освобождая чистые места для работы.

Как стереть тонкие линии клячкой

Сложившаяся практика показывает, что художники, имея желание добиться максимально изящного материала для стирания тонких линий, делили свои стирательные резинки не на одну часть. Используя же клячку, разрезать и делить не придется. Состоящая из натурального каучука, она способна принимать любую форму. Чтобы стереть ею тонкие линии достаточно скатать ее колбаской и сделать заостренные края. Этот манер удобно использовать для создания академического рисунка любой сложности.

Формопластовые клячки

Возможной альтернативой клячки является формопластовый ластик. Его тоже часто называют клячкой. В отличии от обычной всем известной клячки, формопласт липкий на ощупь не способен гнуться и принимать любую форму при смятии. Но он также, имея адсорбирующие свойства, способен собирать угольную и графитовую пыль. Его можно мыть мылом в воде и в виду своего состава имеет длительный срок службы, нежели классическая клячка.

Формопластиковая клячка

Формопласт – это мягкая пластмасса, состоящая из пластификаторов и искусственных смол. Имея у себя в арсенале такой ластик надо быть предельно аккуратными с его хранением. Такой материал способен разъедать пластмассы, поэтому обычная бумага или целлофан обязательное условие при его хранении.

Как выбрать качественную клячку

Ластик, так же как и карандаш имеет все права называться полноценным инструментом для создания художественного рисунка. Ластик необходимо подбирать качественный. К счастью, разные производители клячки выпускают практически одинаковые по своей структуре ластики. Единственным различием может быть степень ее разминания. Некоторые клячки уже с первого нажатия предполагают мягкую и эластичную структуру, а некоторым требуется разминание до нескольких минут или временное нахождение в теплом месте.

Как сделать мягкий ластик самостоятельно

Такую резинку художники могут изготовить самостоятельно. Для того чтобы сделать клячку для рисования своими руками, понадобятся обычные ластики. Их нужно поместить в банку с бензином и оставить на 2-3 дня. После чего получившуюся массу высушивают на бумажных полотенцах и кипятят в чистой воде. В результате должен получиться мягкий ластик, похожий на клячку. Только вряд ли он будет такого же яркого и приятного цвета, как оригинал.

Как очистить клячку после работы

Ластик во время работы поглощает графит и со временем становится слишком грязным. Для того чтобы очистить его, достаточно просто помять массу в ладони, как обычный пластилин. Тогда частицы грифеля распределятся по материалу, и клячкой вновь можно будет пользоваться. Со временем мягкий ластик темнеет и меняет первоначальный оттенок на грязно-серый. Но даже такой клячкой еще можно пользоваться, если хорошо размять ее перед работой, пока ее цвет не станет светло-серым. Но в итоге она все равно станет слишком грязной и непригодной для использования, поскольку графит, уголь, пыль или другие частицы накапливаются внутри пластичной массы. Это небольшая проблема, потому что клячки, как правило, очень дешевые и их можно найти в большинстве магазинов художественных товаров.

Приобретая новый ластик, не используйте всю массу. Отщипните сначала небольшой кусочек, достаточный для работы. Когда внутри накопится графит, клячка станет мягче. Если вам нужно срочно размягчить ластик, натрите грифель карандаша на наждачной бумаге и соедините с массой. После этого нужно просто хорошо размять ее. Теперь вы знаете, что это — клячка для рисования, и сможете применить ее для создания великолепных рисунков.

Поделитесь с друзьями интересной статьей!

Эшли Макмиллан понижает пару канадских записей NAG, чтобы закрыть OJI

2021 Ontario Junior International

Преодолев отметку в 100 брассов в пятницу, Эшли Макмиллан в выходные побила еще два канадских национальных рекорда в возрастных группах, завершив соревнования Ontario Junior International 2021 в Торонто.

Макмиллан, 17-летняя спортсменка из команды Kingfish в Большой Оттаве (GO), прорвалась к победе в субботу в женском заплыве на 100 м на спине с результатом 56.90, чтобы стереть  Taylor Ruck NAG 15-17 из 56,99, установленный в 2017 году.

Макмиллан, который вышел на соревнования, не проиграв ни минуты (лучшее время 1:00,08, в заездах 58,68), также побил рекорд соревнований OJI 57,63, установленный Даниэль Ханус в 2015 году.

Мероприятие ознаменовало собой подиум 1-2-3 для GO: Regan Rathwell заняла второе место с результатом 57,76, а Dylan Scholes заняла третье место с результатом 1:00,87.

Позже на субботней сессии Макмиллан одержала крупную победу в беге на 200 м брассом среди женщин (2:23.97), аннулировав свой предыдущий PB, вышедший на встречу (2: 32,94), при этом приблизившись на секунду к рекорду Kelsey Wog на встрече 2015 года 2: 23,00. Вог также является рекордсменом NAG 15–17 с результатом 2: 21,62.

Имея за плечами уже четыре личные победы (также завоевав 50 в пятницу), Макмиллан сделала идеальный результат шесть из шести в воскресенье, включая сброс еще одного рекорда NAG в 200 IM.

Макмиллан взлетел до времени 2:06,57, побив предыдущий рекорд NAG и встретив рекорд 2:07. 78, установленный Сарой Дарсел в 2016 году. Макмиллан вышел на встречу с лучшим временем 2: 11,46, установленным на OJI 2019 года.

USC завершает дело, одержав шестую индивидуальную победу в воскресенье вечером, выиграв грудь среди женщин 50 за 31.16. Канада не признает записи NAG в 50-х годах.

Макмиллан также участвовал в предварительных соревнованиях 400 IM, прежде чем в пятницу вырвался в финал. Эту гонку выиграл Summer McIntosh Этобико, который не участвовал ни в каких соревнованиях в выходные.

Ее товарищ по команде GO Рэтвелл, член Теннесси 2022 года, также побил рекорд соревнований в воскресенье, выиграв женскую гонку 200 за 2:04,17, побив предыдущую отметку OJI в 2:05,40, установленную Ханусом в 2016 году.

ДРУГИЕ ОСОБЕННОСТИ

  • Плавательный клуб Etobicoke Катрина Беллио продолжила свои победы в 1500 м бесплатно в четверг и 200 м бесплатно в пятницу, завоевав 400 м бесплатно в субботу, коснувшись в 4:04. 26, менее чем на полсекунды от ее PB, установленного в ноябре (4:03.79).
  • Товарищ по плаванию ESwim  Элла Янсен продемонстрировала в целом впечатляющие результаты: семь подиумов в семи видах спорта, одна победа и шесть вторых мест. На выходных Янсен выиграл 200 мух с лучшим временем 2: 08,96 и добавил второе место после Беллио в 400 м фри 200 IM (2:10.01).
  • Markham Aquatic Club’s Elan Daley , 16 лет, выиграла у женщин 50 вольных (25,43) и 100 вольных (54,43).59) соревнования, фиксирующие личные рекорды в обоих. Дейли — канадский рекордсмен NAG в беге 11-12 50 вольным стилем.
  • Ю Тонг (Адам) Ву из плавательного клуба Surrey Knights Swim Club провел клинику среди мужчин на соревнованиях, поднимаясь на подиум во всех восьми своих гонках, четыре из которых были победными. Ву выиграл у мужчин 200 вольных (1:47,67), 400 вольных (3:50,11), 800 вольных (8:05,59) и 200 вольных (1:57,81).
  • Club Aquatique Montreal (CAMO) также продемонстрировал примечательные результаты среди мужчин, так как Loic Courville Fortin выиграл у мужчин 50 (25. 49) и 100 назад (54,12), а Jeremy Koueiki возглавил 100 грудью (1:01,33) и 200 грудью (2:11,68).

Регистрация устройств

Когда дело доходит до регистрации устройств в Канджи, у вас есть много вариантов.

Методы регистрации

Канджи поддерживает несколько различных типов устройств Apple. Существует также несколько различных методов, которые можно использовать для регистрации этих устройств. Ниже приведены поддерживаемые варианты регистрации для каждого типа устройств:

.
Все типы устройств
  • Автоматическая регистрация устройств: ADE отлично подходит для новых или восстановленных устройств, которые были назначены Канджи в Apple Business Manager.
  • Портал регистрации Kandji: Регистрация через портал регистрации Kandji — отличный вариант для устройств, которые уже настроены и/или недоступны для вас в Apple Business Manager.
Устройства macOS
  • Автоматическая регистрация после настройки устройства : Иногда называется «DEP NAG». Это позволяет запустить однострочную команду в терминале, чтобы инициировать уведомление, позволяющее пользователю зарегистрироваться в Канджи с помощью автоматической регистрации устройства.
    • Этот параметр может быть особенно полезен, если ваши устройства уже зарегистрированы в другом решении MDM, так как вы можете использовать этот старый MDM для отмены регистрации устройств и установки LaunchDaemon для запуска DEP NAG, предлагающего вашим пользователям зарегистрироваться в Kandji.
Устройства iOS, tvOS и iPadOS
  • Apple Configurator 2: Если у вас есть устройства iPhone, iPad, Apple TV или iPod touch, которые были приобретены не через Apple Business Manager, вы можете вручную добавить эти устройства в ABM с помощью приложения Apple Configurator 2.

Что делать, если ваше мобильное устройство уже настроено и зарегистрировано в другом MDM с помощью автоматической регистрации устройств? У вас есть два варианта:

  • После повторного назначения устройства Канджи через Apple Business Manager сотрите и повторно зарегистрируйте свои мобильные устройства, если хотите сохранить контроль в Канджи.
  • Отмените управление мобильным устройством в существующем MDM и используйте веб-портал регистрации Kandji. Примечание. Это не приведет к тому, что ваши устройства будут находиться в контролируемом состоянии.

Как зарегистрироваться
Автоматическая регистрация устройств (все типы устройств)

Регистрация устройств с помощью автоматической регистрации устройств гарантирует, что Канджи нельзя будет удалить с устройства, если это не разрешено.

Автоматическая регистрация устройств (новые или восстановленные устройства)

  1. Назначьте устройства Mac или iOS серверу Kandji MDM в Apple Business Manager.
  2. Перейдите к Devices > Automated Device Enrollment , чтобы убедиться, что нужные устройства перечислены в Kandji.
  3. Включите устройство, подключитесь к Интернету и запустите Ассистент настройки. Экран удаленного управления во время процесса установки подтвердит, что регистрация прошла успешно.

Автоматическая регистрация устройства (после настройки устройства) (только macOS)

Если компьютер Mac уже прошел через Ассистент настройки, можно принудительно выполнить еще одну проверку и повторно зарегистрировать компьютер в Канджи. После назначения устройства серверу Kandji MDM в Apple Business Manager убедитесь, что выполнены следующие шаги.

Если вы переходите с существующего MDM, вы можете установить LaunchAgent перед удалением из текущего MDM, чтобы выполнять эту команду ежедневно. Это предложит вашим пользователям зарегистрироваться в Канджи.

  1. Откройте терминал и выполните следующую команду:
     профили sudo -N 

    или (эти команды выполняют одну и ту же функцию)

     профили sudo обновляют регистрацию 
  2. В правом углу Mac отобразится уведомление-баннер с предложением зарегистрировать устройство в Канджи. Нажмите на Подробности в уведомлении баннера.

  3. Системные настройки откроются для подтверждения регистрации; выберите Разрешить . Затем Mac зарегистрируется в Канджи.

Назначение устройства в Apple Business Manager
  1. Войдите в Apple Business Manager и выберите Назначение устройств на левой панели навигации.
  2. Выберите конкретный идентификатор и введите соответствующую информацию в текстовое поле.

  3. Выберите Назначить серверу  в раскрывающемся списке Выполнить действие .

  4. Выберите Выберите Сервер MDM в раскрывающемся списке Сервер MDM и выберите сервер Kandji, который вы создали при включении MDM с Kandji.

  5. Чтобы все новые приобретаемые устройства автоматически назначались Канджи, выберите Настройки на левой панели навигации.
  6. Выберите Настройки управления устройством .
  7. В разделе Настройки управления устройством в разделе Назначение устройства по умолчанию вы можете автоматически назначить каждому типу устройства схему по умолчанию, которую вы настроили в веб-приложении Kandji.

Обратите внимание, что Blueprint по умолчанию можно изменить в любое время в веб-приложении Kandji.

Сделать устройства доступными для назначения в Apple Business Manager
  • Если вы не видите доступные для назначения устройства в своей учетной записи Apple Business Manager, это может быть вызвано несколькими причинами, для каждой из которых существуют разные решения.
    • Вы приобрели свои устройства напрямую у Apple.
      • Возможно, вы не добавили свой номер клиента Apple в Apple Business Manager ( Настройки > Настройки управления устройством > Номера клиентов ).
      • Чтобы узнать свой номер клиента Apple, обратитесь к менеджеру по работе с клиентами Apple или в отдел закупок, либо обратитесь в службу поддержки продаж Apple. При использовании номера клиента Apple все устройства, приобретенные у Apple с 1 марта 2011 г., будут добавлены в вашу учетную запись Apple Business Manager.
    • Вы приобрели свои устройства у авторизованного реселлера Apple или оператора связи.
      • Возможно, вы не установили связь между своей учетной записью Apple Business Manager и торговым посредником.
        • Узнайте у реселлера его идентификатор реселлера и добавьте его в Apple Business Manager  ( Настройки > Настройки управления устройствами > Номера клиентов ).
        • Предоставьте торговому посреднику свой идентификатор организации Apple Business Manager, расположенный в Apple Business Manager  ( Настройки > Информация о регистрации ), а также список серийных номеров или заказов, которые вы хотите, чтобы торговый посредник добавил в свой Apple Business Manager. Счет.Период ретроспективного анализа для добавляемых устройств определяется вашим торговым посредником.
      • Возможно, ваши устройства не были приобретены через торгового посредника, поддерживающего регистрацию устройств, или не были приобретены у Apple в коммерческих целях.

    В этой статье службы поддержки Apple рассматриваются вопросы о номерах клиентов и добавлении устройств в Apple Business Manager 

    В этой статье службы поддержки Apple содержится список реселлеров, поддерживающих регистрацию устройств; обратите внимание, что даже если вашего торгового посредника нет в списке, он все равно может добавить ваши устройства

    Устройства уже настроены, но недоступны в Apple Business Manager
    1. Перейдите к Добавить устройства на левой панели навигации веб-приложения Kandji.
    2. Если портал регистрации активен, у вас будет настраиваемая ссылка на портал регистрации , которую вы можете предоставить своим пользователям, чтобы они могли зарегистрировать свои устройства.
    3. Предоставьте пользователю пользовательскую ссылку на портал регистрации и код регистрации для схемы, в которой вы хотите зарегистрировать свое устройство.

    Эли Буэндиа говорит, что твит о воссоединении Eraserheads был «полусерьезной шуткой»

    Эли Буэндиа осудил надежды фанатов на то, что Eraserheads снова соберутся вместе, назвав свой недавний твит о возможном воссоединении «полусерьезной шуткой».

    В прошлом месяце Буэндиа ответил на вопрос фаната о воссоединении Eheads « Pag tumakbo si Leni » — «Если Лени будет баллотироваться», имея в виду, будет ли нынешний вице-президент Филиппин Лени Робредо баллотироваться на предстоящие национальные выборы.

    На прошлой неделе Робредо объявила о выдвижении своей кандидатуры, что вызвало дерзкое ожидание воссоединения Головы-ластик в социальных сетях.

    • ПОДРОБНЕЕ: Бывший фронтмен Eraserheads Эли Буэндиа: «Долгое время у меня была фишка на плече, и теперь я признаю, что она достала меня»

    После этого Буэндиа ответил на этот твит на пресс-конференции своего виртуального концерта Superproxies, пояснив, что он был сделан в основном в шутку. «Этот ответ был далек от политического поста. Я уважаю и восхищаюсь Лени. Если бы я голосовал, она сейчас была бы моим главным кандидатом. Этот твит был, может быть, наполовину серьезной шуткой, но люди превратили его в большое дело», — сказал он, цитируя ABS-CBN .

    Бывший барабанщик

    Eraserheads Рэймунд Марасиган также сказал, что не знал о так называемых планах по воссоединению группы.

    «Давайте просто обратимся сюда para isang sagutan na lang — один, я ничего не знаю.Если речь идет о том, что «Heads играют вместе, моя политика заключается в том, чтобы сообщить мне об этом, когда я буду готов подписать контракт и начать репетировать», — сказал Марасиган в ответ на вопросы фанатов согласно ABS-CBN .

    Марасиган также отметил, что твит Буэндиа не следует принимать за чистую монету, сказав: «Иногда смысл выходит за рамки твита». Бывший барабанщик добавил, что ему «было забавно», что группу преследуют по политическим мотивам.

    Помимо твита о Робредо, Буэндиа дал еще два шутливых ответа на вопрос о возможности воссоединения группы, в том числе «Иисус должен вернуться» и о возвращении IV of Spades, которые взяли перерыв.

    Пагнаг воссоединение 4 пики https://t.co/MXy0Y7JAio

    — Эли Буэндиа (@elybuendia9001) 28 сентября 2021 г.

    Иисус должен вернуться. https://t.co/Oy8ZIkr0qO

    — Эли Буэндиа (@elybuendia9001) 28 сентября 2021 г.

    После реакции фанатов на дерзкий твит Буэндиа о воссоединении Eraserheads, 10 октября артист снова обратился в социальные сети, чтобы пояснить, что его первоначальное замечание было «легкомысленной» шуткой, но он «совершенно серьезно относится к будущему нашего народа».

    Хотелось бы, чтобы у меня было больше времени на общение с фанатами, некоторые из которых, я уверен, не разделяют моих политических взглядов. Но за несколько минут мы нашли общий язык, и это человечество. Это то, что мы все разделяем, и то, что должно больше всего находить отклик у лидера. #LetLeniLead2022

    — Эли Буэндиа (@elybuendia9001) 10 октября 2021 г.

    Буэндиа продолжил в отдельном твите, заявив, что, несмотря на то, что некоторые фанаты не разделяют те же политические взгляды, что и он, «на несколько минут мы нашли общий язык, и это человечность.Это то, что мы все разделяем, и то, что должно находить наибольший отклик у лидера».

    Разрушенные надежды на воссоединение, EP Eraserheads «Sabado/1995» выходит на виниле. На прошлой неделе лейбл Offshore Music представил сопутствующие товары в сотрудничестве с брендом одежды Continue.

    Это захватывающее сотрудничество с Continue. представляет вам мерч ограниченной серии Eraserheads Sabado/1995…

    Опубликовано Offshore Music в пятницу, 8 октября 2021 г.

    конститутивной экспрессии в Наг-Like диоксигеназой Gene через внутренний Promoter в 2-хлорнитробензола Катаболизм кластер генов из Pseudomonas stutzeri ZWLR2-1

    GATTTCTACCTGTCGCCGACCCGC РР3 903 86 TGTTTAGTCCAGCTTGATCACCACCAGCTTGATCACCAC
    RT-PCR
    PP1 cnb1603 сек РР1
    РР1 cnb2165 с TGGAGGACAAGCTGGGGGAAGATCG
    PP2 cnb2117 сек CCGTGACGACCAATCACATACAGGC ФП2
    ФП2 cnb2712 с GATCGCGCAGCATGTGCTTATTTTC
    PP3 cnb2645 сек GGAAAATGTGGATTTCGATCTGCCG
    РР3 cnb3153 с CCTGGCGAATTCCGTTCACAATGTC
    РР4 cnb3590 сек TCCCTACAAGATCCCGGATCAAGGC РР4
    РР4 cnb4145 CTCGCGTAT GCTCTGCCAGCTCTCC
    PP5 cnb3946 сек TGCGCTGTTCCACGACGGGGAGATC РР5
    РР5 cnb5633 CGGATCGCGTCTGGCTCCAACGGAC
    PP6 cnb5630 сек TCCGCGCTTTGCTCGAAAACATCTG РР6
    РР6 cnb6105 с GCCCACGACGACAAAGACCTCATCC
    pp7 cnb7023 сек ATACGCCGATCTGCCCTGGCTATGG РР7
    РР7 cnb7439 CTGGTGGGTGAGCACCGCGCGACTG
    РР8 cnb8417 сек CGATGAAGCCAAGCTGCGCCACTAC РР8
    РР8 cnb8997 с AaatccGTCATCGTTCGTCCGTCCGTTTCCGTCCGTCC
    PP9 CNB8827 S CGCCGATCAGTGGCACGAATTATTAT PP9 PP9
    PP9 CNB9833 A ACAGGGCGGTGAT TTGACGTGG
    PP10 cnb9659 сек GTGCGCCTTGTGGAGAGAGCTTTTG РР10
    РР10 cnb10164 с ATGGCCCGGTGAGCCCTCGGTGATG
    РР11 cnb10467s CTTCCTGTCCCAGGTCTACGCAAGC РР11
    РР11 cnb11065a GGAGCCATAGCCCCAGCCGTGGTAA
    РР12 cnb11185s CTGTTTTGATGCAGAAGCTCCCCCG РР12
    РР12 cnb12715a GCAACAGAGCCCAGGCAGGCATCCC
    QRT-ПЦР
    QCnbC3070s GGACAAGAAGCGTTAGGAGCG
    QCNBC3225A GACATCGAGCATAGCGGAATC
    Qreale4253s GGCGGTCTCTTCGTCTC 9038 7
    QrealE4353a TCAAGCACCTCCTGATTGG
    QCnbF4772s GCTTCGATCTCCGACCTCTTC
    QCnbF4885a GAGACCATCCGCGTTTGCTTC
    QCnbAb5959s GCCTTTTCGACATCGAGACAG
    QCnbAb6066a TTCCCAGCATCACCTCCAAGC
    QCnbAa 6058 сек TGCTGGGAAGTCAGGCCGATG
    QCnbAa 6217 ATAGGGGCGGGCGCTCATAGG
    QCnbD 7296 с ATGAGCGCAGAGGCCGCACTTC
    QCnbD 7454 GCGAACGATCAGGTAGCTCTGGTGG
        QcnbAc10812s CTTTTCCAGCACGAGATGAAGACC
        QcnbAc10918a

    86 GCCCATTT GTGAC

    QCnbAd 12253 сек GCTTGGCTTGAACACTTCGTTGC
    QCnbAd 12374 TAGTTCTCGTTGTAGATGTTCACCG
    RT2085s ACCTCTGACTGCCGCCAATCTTTGC
    RT5565s CCGGGCCGTCGAGCTGATCTTCAAG
    RT7812a GCTTCTCCTGCGCTTCGGCGATATC
    16S s1 CATGCTGAGAACCTGCCAGAG
    16S a1 CTTAGAGTGCCCACCATAACG
    Promoter скрининг
    PA13s EcoR I CTGAATTCGTTCCCGAGTCGGTGTCGCCGAAC PA
    PA495A BAMH I CGGGATCCTCACAGATGCAGGCGTCCTGCAGATGCAGCGGTCCTGCH
    PB 1252S ECOR I 9038 7 CGGAATTCAAGCTTGAGCATGCTTGGCG PB
    ПБ 1498a BamH I CGCGGATCCAGCGCAGCCGCTTCTCCATC
    PC 2868s PstI AAAACTGCAGGACGCTATGTCGATCGC PC
    ПК 3175a HindIII GCCCAAGCTTGCCTGACCAGGACCTGGC
    PD 10752s EcoR I CGGAATTCGTGAGTGAAGCAGGGCTGAC PD
    PD 11285a BamH I CGCGGATCCCCAGGCCACCAGAGTGCTTG
    ПЭ 11120s EcoR I CGGAATTCATGCCTGGGCTTGAAAGAAG РЕ
    ПЭ 11504a BamH I CGCGGATCCACATTACGCTCATTCCACTG
    pf 12197s psti aaaactgcagactcctgacccgagaagcaccaccccccccagaagcac PF
    PF 12710A Hindiiii Acccaagcttcaggcatccccagggttcac 9 0387
    PG 879s EcoR I GCGAATTCTGCGGGCACTTTGGTGCCGCGTG PG
    PG 1433a BamH I CGGGATCCGACCGAAATGCCGCGTTCCGCC
    Ph2601s EcoR I TCGAATTCTACCTGTCGCCGACCCGC PH
    Ph3075a BamH I CGCGGATCCGATCAGGCGGCTGCTGCGAAATG
    PI 2027s PstI AAAACTGCAGTGGGCATGCTCAACCACCATTTCG ПИ
    ПИ 2524a HindIII GCCCAAGCTTATTGCCTGGTTCATTGGACATCC
    Р1 2578 PstI AAAACTGCAGACAACGACAATCTGGAAGCATG Р1
    { «Тип»:» Entrez-белок «,» attrs «: {» текст «:» P13052 «,» term_id «:» 114568 «,» term_text «:» P13052 «}} P13052 Hindiii A GCCGAAGCTTCCCCCCCGGGGCATACCGA
    P2 8473 Ecoris СС GGAATTCTTTCGTCGCCACCATCAAGAACAAG Р2
    Р2 8968 PstI AAAACTGCAGTCCGCCAAGCATGCTCAAGC
    Р3 10419EcoRIs CCGGAATTCCATCGATGGCACCAGAGTG Р3
    Р3 10759PstIa GGAACTGCAGTAAGTTTTGGTAACTCATAATTG
    5 ‘RACE
    CNBC R2 GGGCGCATTCGGCAGATAATAGGG
    CNBC R3 AATCTCGCCCGCTTCACCCGTTT
    cnbAc R2 GCAAAATAGATGCGTGCGTCCAACC
    cnbAc R3 CGTTCTGGCGGGAGACGATGACTT
    ИКМ gfplacZ построение векторов, связанных ATGGCACCAGAGTG
    ИКМ gfplacZ Р3 TCATGGTCATGGATCCTAAGTTTTGGTAACTCATAATTG
    ИКМ gfplacZ Р32 сек CTCCACTGACAGAAAGCATGCAGCCTTGTGCACACCCCTG
    ИКМ gfplacZ Р32. 5 с CTCCACTGACAGAAAGCATGCATGCTCAAGCTGGACTAAATG
    -35 область мутации
    1 М ggaa CATTTAGTTTAGCTTGAGCATCACGCGCATG
    1 M ggaa сек CTCAAGCTAAACTAAATGCTCAAGCTGGACTAAAAC
    2 М ACGT в TTTAACCCAGCTTGAGCATCAC
    2 M ACGT сек TGCTCAAGCTGGGTTAAATGCTCAAGCTG
    3 М ВАРУ с CATTGCGTCCAGCTTGAGCATCAC
    3 М ВАРУ s2 CAAGCTGGACGCAATGCTCAAGCTGGACTAAAAC
    4 м AAGG A CacctagCCAGCTTGAGCATCACG
    4 м AAGG S2 CTCAAGCTGACTACTAGGTGCTCAAGCTGACTAAAC
    5 M TGCA A
    5 M TGCAAGCTGGACTAACACTCAAGCTGGACTAAAC

    Как восстановить iPhone, который зависает на экране Apple | Small Business

    Если ваш iPhone завис на экране Apple во время загрузки, выполните перезагрузку аккумулятора или «сброс», чтобы устройство полностью выключилось и снова загрузило iOS. Сброс отличается от перезагрузки телефона, поскольку устройство не полностью отключается при простом перезапуске. Если iPhone продолжает зависать при включении, телефон можно исправить, войдя в режим восстановления или режим DFU и выполнив восстановление. Восстановление iPhone удаляет все сохраненные данные и приложения на устройстве.

    Как сбросить или перезагрузить зависший iPhone

    Одновременно нажмите и удерживайте кнопки «Домой» и «Питание» и подождите, пока экран не станет черным.Процесс должен занять около 10 секунд.

    Дождитесь перезагрузки iPhone. Если телефон не перезагружается сам по себе, снова нажмите и удерживайте кнопку питания.

    Дайте iPhone загрузить iOS. Если телефон не загружается в iOS через 10 минут, скорее всего, телефон нужно снова восстановить для работы.

    Как восстановить зависший iPhone в режиме DFU

    Откройте iTunes на компьютере и подключите iPhone к USB-адаптеру.

    Нажмите и удерживайте кнопки «Домой» и «Питание» на iPhone в течение 10 секунд.

    Отпустите кнопку «Питание» и продолжайте удерживать кнопку «Домой» еще пять секунд. Экран должен оставаться черным. Если всплывает телефон с сообщением «Подключите iTunes», процесс следует повторить еще раз, начиная с шага 2.

    Нажмите «ОК» во всплывающем окне на компьютере с сообщением «iTunes обнаружил iPhone в Recovery Mode», чтобы начать процесс восстановления iPhone. Восстановление iTunes вернет iPhone к самой новой версии iOS, доступной для устройства.

    Как восстановить зависший iPhone в режиме восстановления

    Подключите кабель USB к компьютеру и загрузите iTunes.

    Нажмите и удерживайте кнопки «Домой» и «Питание» одновременно в течение 10 секунд, чтобы принудительно выключить iPhone.

    Отпустите кнопку «Питание», а кнопку «Домой» продолжайте удерживать.

    Подключите USB-кабель к iPhone.

    Продолжайте удерживать кнопку «Домой», пока не появится сообщение об обнаружении устройства в режиме восстановления.

    Отпустите кнопку «Домой» и нажмите «ОК» на iPhone.

    Следуйте инструкциям на экране, чтобы восстановить iPhone.

    Ссылки

    Советы

    • Если телефон загружается в iOS пять или более минут и после сброса работает с перебоями, вероятно, в телефоне возникли проблемы с iOS. Чтобы устранить эту проблему на iPhone, создайте резервную копию телефона в iTunes, восстановите телефон до заводских настроек и восстановите телефон до точки резервного копирования в iTunes, чтобы не потерять все данные, хранящиеся на устройстве.

    Предупреждения

    • Восстановление iPhone без предварительного резервного копирования безвозвратно удалит все данные, хранящиеся на устройстве.

    Биография писателя

    Дэн Стоун начал профессионально писать в 2006 году, специализируясь на образовании, технологиях и музыке. Он веб-разработчик в коммуникационной компании, ранее работал на телевидении. Стоун получил степень бакалавра гуманитарных наук в области журналистики и магистра гуманитарных наук в области коммуникативных исследований в Университете Северного Иллинойса.

    FireAlpaca 2.7.1 СКАЧАТЬ | Бесплатная программа для рисования FireAlpaca

    последняя версия:

    2.7.1 (11.01.2022)

    ZIP-версия Windows

    32-битная zip-версия Windows

    Windows 64-разрядная zip-версия

    32-разрядная версия установщика Windows

    64-разрядная версия установщика Windows

    Загрузить старую версию

    Часто задаваемые вопросы

    Могу ли я использовать иллюстрацию, созданную с помощью FireAlpaca, в коммерческих целях?

    Да, нет проблем.Любую иллюстрацию, созданную с помощью FireAlpaca, можно использовать для любых целей.

    Кому принадлежат авторские права на иллюстрации, созданные с помощью FireAlpaca?

    Художник создал иллюстрацию.

    Могу ли я создавать товары с помощью персонажа FireAlpaca и продавать их?

    Запрещено создавать товары с использованием персонажа и логотипа FireAlpaca без разрешения. Пожалуйста, свяжитесь с нами заранее.

    Могу ли я поделиться скриншотом, содержащим программу FireAlpaca?

    Да, пожалуйста, не стесняйтесь использовать изображения для учебных пособий, статей, сообщений в блогах, социальных сетей, таких как Twitter, и т. д.

    Условия обслуживания

    Пожалуйста, внимательно прочитайте эти условия перед использованием FireAlpaca («бесплатное программное обеспечение» или «услуга»), предоставляемой PGN Inc. («нас», «мы» или «наш»). Если вы используете наш сервис, вы соглашаетесь со всеми условиями, перечисленными ниже. Ваша загрузка этого бесплатного программного обеспечения и использование службы зависят от вашего согласия и соблюдения этих условий. Если вы не согласны с какой-либо частью условий, вы не можете загружать сервис.

    • Лицензия

      FireAlpaca — это бесплатное программное обеспечение, которое не требует уплаты каких-либо лицензионных сборов как для индивидуальных пользователей, так и для коммерческого использования.
    • Авторское право

      Это бесплатное программное обеспечение, его содержимое и интеллектуальная собственность защищены авторским правом PGN Inc.
    • Распределение

      Любое распространение или воспроизведение части или всего содержимого в любой форме запрещено.Вы не имеете права, кроме как с нашего письменного разрешения, распространять или использовать в коммерческих целях содержимое любого другого веб-сайта, журнала или публикации.
    • Запрещенные действия

      Пользователи не должны совершать следующие действия:
      • Распространение программного обеспечения
      • О распространении ПО
      • Другие действия, наносящие ущерб нашей компании
    • Прекращение обслуживания

      Если по какой-либо причине мы считаем, что вы не соблюдаете настоящие условия предоставления услуг, мы можем по собственному усмотрению прекратить использование вами FireAlpaca немедленно и без предварительного уведомления.
    • Прекращение обслуживания

      Мы можем прекратить выпуск части или всего бесплатного программного обеспечения без предварительного уведомления. Мы не несем ответственности за какой-либо ущерб, включая, помимо прочего, потерю производства, потерю прибыли, потерю дохода, потерю данных или любой другой деловой или экономический ущерб, вызванный прекращением деятельности.
    • Ограничение ответственности

      Мы не несем юридической ответственности за неисправность этого бесплатного программного обеспечения и не обязаны его ремонтировать.Использование программного обеспечения, загруженного через наш сайт, осуществляется на ваше усмотрение и риск, и вы соглашаетесь с тем, что вы будете нести единоличную ответственность за любой ущерб вашей компьютерной системе или потерю данных в результате таких действий.
    • Изменение условий

      Мы можем изменить условия обслуживания в любое время без предварительного уведомления. Измененные условия вступают в силу с момента их публикации на нашем веб-сайте.

    История обновлений FireAlpaca

    FireAlpaca Версия 2.7.1(2022/01/11)

    • Добавлена ​​кисть симметрии плитки «Полукапля».
    • Улучшена кисть симметрии плитки.
    • Теперь можно указать цвет отображения кожицы лука.
    • Скорректирована ширина полосы прокрутки при высоком разрешении (Windows)

    История прошлых обновлений

    [2.7.0]
    • Добавлена ​​функция пользовательского градиента.
    • Добавьте фильтр карты градиента.
    • Теперь можно копировать несколько слоев, пока они выделены.
    • Интегрированные изображения теперь можно копировать (меню Правка).
    • Экспорт в формат файла ICO.
    • Добавлена ​​возможность добавления кистей из изображений холста (интегрированный холст, несколько материалов на слой).
    • Исправлена ​​ошибка при указании края акварелью.
    • BigSur, Монтерей поддерживает запуск рекламы и отображение магазина кистей (macOS).
    [2.6.7]
    • Улучшен пользовательский интерфейс настройки непрозрачности слоя.
    • Непрозрачность слоя теперь можно изменить, щелкнув метку непрозрачности слоя.
    • Непрозрачность теперь отображается в списке слоев.
    • Улучшен предварительный просмотр сценария кисти.
    • Улучшено поведение привязки к окружности и привязки к кривой.
    • Добавлена ​​поддержка непрерывного заполнения инструмента перетаскиванием.
    • Теперь кисти можно импортировать и экспортировать в виде файлов из меню «Кисти».
    [2.6.6]
    • Исправлена ​​ошибка, из-за которой холст неожиданно поворачивался при использовании стилуса TabletPC (Windows).
    • Более быстрое сохранение файлов MDP.
    • Ускорьте кисть размытия.
    • Ускорен фильтр размытия по Гауссу.
    [2.6.5]
    • Исправлена ​​проблема, из-за которой кнопка 1px на слое могла быть нажата во время преобразования слоя, что приводило к исчезновению слоя в преобразованной области.
    • Улучшено положение полосы прокрутки при переключении между инструментом «Кисть» и инструментом «Ластик».
    • Цвета слоя теперь можно указывать с помощью значений RGB.
    [2.6.4]
    • Обработка кистей была радикально изменена в версии 2.6.0, но из-за множества сообщений об ошибках обработка была возвращена к тому, что было в версии 2.5.9.
    • В меню «Файл» добавлена ​​функция «Открыть папку автоматического резервного копирования».
    • Исправлена ​​ошибка в обработке сценария кисти.
    • После добавления 3D-перспективы инструмент автоматически переключается, чтобы его можно было использовать немедленно.
    • Кнопка «Добавить материал Koma» добавлена ​​в параметры инструмента «Разделить».
    [2.6.3]
    • Исправлена ​​ошибка в работе с текстом стилусом при использовании TabletPC (Windows).
    [2.6.2]
    • Исправлена ​​ошибка, из-за которой в версиях 2.6.0 и 2.6.1 снижалась точность и отслеживаемость кисти.
    • Исправлена ​​ошибка в фильтре кривой тона.
    • Базовая точка сценария кисти теперь может быть сброшена (меню «Кисть»).
    • Магазин кистей можно открыть из меню кистей.
    [2.6.1]
    • Исправлена ​​ошибка, вызывавшая сбой при нажатии кнопок alpaca и pixiv.
    [2.6.0]
    • Обработка кистью была радикально изменена, чтобы координаты мазков кисти не были упущены.
    • В режиме анимации неотображаемые кадры больше не объединяются.
    [2.5.9]
    • Добавлена ​​поддержка преобразования слоев и частичного перемещения при выборе нескольких слоев.
    • Поддерживает фильтрацию путем выбора нескольких слоев (некоторые не поддерживаются).
    • Поддерживает преобразование типа слоя (bpp) путем выбора нескольких слоев.
    • Добавлена ​​поддержка применения цвета переднего плана при выборе нескольких слоев.
    • Ускорен процесс группировки нескольких слоев в папки.
    • Изменено, чтобы сохранить исходное имя файла при сохранении с датой.
    • Исправлена ​​ошибка, из-за которой автовоспроизведение анимации было медленным.
    [2.5.8]
    • Исправлен сбой при попытке открыть и закрыть свойства слоя в папке анимации в режиме анимации.
    [2.5.7]
    • Добавлено меню «Анимация» и перемещены туда функции анимации.
    • Теперь можно указать время отображения каждого кадра во время автовоспроизведения (устанавливается в свойствах слоя).
    • Вывод APNG и GIF теперь отражает время отображения кадра.
    • Исправлена ​​ошибка, из-за которой цвет фона не применялся во время автозапуска.
    • Улучшена обработка при масштабировании изображений.
    [2.5.6]
    • Исправлена ​​проблема с трансформацией слоя при перелистывании влево и вправо.
    • При преобразовании слоя для подтверждения можно использовать Ctrl+T.
    • Увеличен размер курсора для дисплеев с высоким разрешением.
    • Другие мелкие улучшения.
    [2.5.5]
    • Направляющие линии теперь отображаются при использовании симметричных кистей (параметр инструмента «Кисть»).
    • Исправлена ​​ошибка при сохранении перезаписей (если вы используете 2.5.0 до 2.5.4, обновите).
    [2.5.4]
    • Добавлена ​​функция симметричной кисти (некоторые типы кистей не поддерживаются).
    • Ускорьте растровую кисть и точечную кисть.
    • Предел резервного копирования для автосохранения изменен на 30 файлов.
    • Количество циклов теперь можно указать для вывода APNG.
    • Исправлен сбой давления в скрипте кисти.
    [2.5.3]
    • Исправлена ​​ошибка, из-за которой иногда не удавалось перезаписать и сохранить файлы MDP.
    [2.5.2]
    • Исправлена ​​ошибка, из-за которой текстуры кистей не применялись к рассеивающим кистям и т. д.
    [2.5.1]
    • Добавлен новый тип кисти — Scatter Mix Brush.
    • Исправлена ​​проблема, из-за которой слои в папке не обновлялись при перезаписи после преобразования папки.
    • Исправлена ​​ошибка отображения холста.
    [2.5.0]
    • Добавлена ​​поддержка отображения пользовательского интерфейса в средах с высоким разрешением (Windows)
    • Улучшен отклик на мультисенсорные операции (Windows)
    • Исправлена ​​ошибка сохранения и загрузки позиций окна (стандартные настройки окна сбрасываются один раз).
    • Значительно ускорена перезапись и сохранение файлов MDP.
    • Добавлен параметр для предотвращения бесконечного цикла при выводе анимированных GIF и APNG.
    [2.4.6]
    • Текстуры теперь можно применять к растровым изображениям и точечным кистям.
    • Улучшена форма интерполяции мазков кистью.
    • Исправлена ​​ошибка при замене нескольких слоев.
    • Исправлена ​​ошибка при изменении разрешения холста.
    [2.4.5]
    • Исправлена ​​ошибка обработки кисти.
    • Улучшена обработка при изменении разрешения холста.
    • При обрезке или изменении разрешения холста координаты привязки кисти теперь также связаны.
    [2.4.4]
    • Оптимизированная обработка кистью.
    • Улучшено поведение при использовании инструмента «Перо выбора».
    • Исправлена ​​ошибка вызова функции last() в скриптах кисти.
    • Исправлена ​​ошибка в функции анимации.
    [2.4.3]
    • Исправлена ​​ошибка при использовании сценария кисти.
    • Добавлена ​​функция вывода отладки в редактор сценария кисти.
    • Функция bs_debug_log() теперь может выводить строку в редактор сценария кисти (см. пример 5).
    [2.4.2]
    • Исправлена ​​ошибка, из-за которой функция last() в некоторых случаях не работала в скриптах кисти.
    • Исправлена ​​ошибка в редакторе сценариев кисти.
    [2.4.1]
    • Добавлена ​​функция Clear Through.
    • При подтверждении полигонов и кривых теперь подтверждается не только двойным кликом, но и долгим нажатием.
    • Теперь вы также можете перетаскивать цвет из активного слоя.
    • Добавлена ​​настройка инструмента «Пипетка».
    • Исправлена ​​проблема с отсутствующими слоями при привязке с помощью кисти для смазывания или смешивания цветов.
    • Другие мелкие улучшения.
    [2.4.0]
    • Теперь вы можете загружать материалы для кистей и легко добавлять высококачественные кисти (подробности см. здесь).
    • Текстура теперь применяется к кистям, чтобы создать богато текстурированный вид.
    • Добавлены предустановленные кисти.
    • Улучшено поведение инструмента «Точка».
    • Исправлена ​​ошибка в ручке выбора.
    • Улучшено качество рисования фигур.
    • Исправлена ​​ошибка защиты прозрачности японского фильтра.
    [2.3.18]
    • В кнопку из альпаки добавлена ​​функция сохранения изображений рабочего пространства.
    • Исправлена ​​проблема с сочетаниями клавиш.
    • Исправлена ​​ошибка, из-за которой холст, загружающий APNG, находился в нестабильном состоянии.
    [2.3.17]
    • Анимацию теперь можно экспортировать в виде анимированных GIF-файлов
    • Теперь вы можете открывать файлы из недавно использованных папок
    • Добавлены кнопки Transform / Free Transform / Mesh Transform на панель параметров
    • Добавлена ​​поддержка отображения/скрытия сочетаний клавиш слоя
    • Возможно, вам удалось исправить ошибку, из-за которой COM Surrogate блокирует файл и предотвращает его перезапись (Windows)
    [2.3.16]
    • Исправлена ​​ошибка привязки клавиши Shift при использовании инструмента перемещения
    [2.3.15]
    • Исправлена ​​ошибка в текстовом инструменте, возникавшая при исправлении 2.3.14
    [2.3.14]
    • Исправлена ​​ошибка обработки мультитач при использовании инструмента перемещения (Windows)
    • Улучшен режим наложения при группировке нескольких слоев в папки
    [2.3.13]
    • Теперь возможен импорт и экспорт файлов PNG формата APNG
    • Улучшено преобразование папки слоя при включении скрытого слоя
    [2.
    3.12]
    • Исправлена ​​ошибка, из-за которой скорость кисти скриптового типа была низкой.
    • Улучшено отображение слоя при переходе из меню к предыдущему/следующему кадру с помощью функции анимации.
    [2.3.11]
    • В новый диалог добавлена ​​вкладка «Анимация».
    • Улучшено отображение управления цветом в новом диалоговом окне.
    • Изменен «Режим луковой кожицы» в меню дисплея на «Режим анимации».
    • Исправлена ​​ошибка, из-за которой диалоговое окно автоматического воспроизведения анимации скрывалось за главным окном (версия для macOS).
    • Улучшено поведение диалогового окна объявления о запуске.
    • Улучшено поведение операции вставки слоя.
    • Улучшено качество растровой кисти.
    [2.3.10]
    • Теперь вы можете работать, оставив окно автоматического воспроизведения функции луковой шелухи открытым.
    • Повышена точность определения частоты кадров при автовоспроизведении.
    • Исправлена ​​проблема, из-за которой экран мерцал сразу после рисования кисти.
    [2.3.9]
    • Улучшено качество прорисовки растровых кистей.
    • При добавлении скрипта кисти получить имя кисти из функции default_name (если оно не существует, это будет имя файла).
    [2.3.8]
    • Исправлена ​​ошибка ползунка поворота текста
    • Повернуть текстовый слой из меню
    • Поддержка сочетаний клавиш F13–F24
    [2.3.7]
    • Поддержка поворота текстовых слоев
    • Включено добавление предустановленных кистей по отдельности с помощью кнопки добавления кисти
    • Добавлен список ластика
    • Цветовые палитры теперь можно сохранять и загружать в файл
    • Исправлена ​​ошибка после выбора группы в цветовой палитре
    • Включена работа колеса при использовании инструмента кисти формы
    [2.3.6]
    • Добавлена ​​опция случайного вращения для каждого штриха (случайное вращение 2) (растровое изображение, растровая акварель)
    • Добавлена ​​возможность обнуления давления пера на обоих концах мазка кисти
    • Поддерживает несколько групп цветовых палитр
    • Добавлена ​​возможность удалять все палитры в группе
    • Дисплей с большой палитрой
    • Соответствует операции колеса во время операции перетаскивания в инструменте выделения/заливки
    • Улучшено поведение диалогового окна сохранения файла
    • Исправлена ​​ошибка в справочном окне
    • Улучшено поведение при использовании Windows Tablet
    [2.
    3.5]
    • Смешение при добавлении папки слоя изменено на «нормальное» (потому что есть много сообщений о том, что обрезка не может быть выполнена). Вы также можете изменить настройку среды на «сквозную».
    • Теперь вы можете импортировать содержимое буфера обмена в окно документа
    • Исправлена ​​ошибка, иногда возникающая при рисовании кистью непосредственно на холсте, когда активно другое окно
    [2.3.4]
    • Исправлена ​​проблема с пипеткой на планшете Windows
    • .
    • Статус клавиши модификатора теперь отображается в строке состояния
    • Некоторые другие небольшие улучшения
    [2.3.3]
    • Исправлена ​​проблема, возникавшая после двойного щелчка холста.
    • Исправлена ​​ошибка инструмента перемещения.
    • Исправлена ​​проблема с миганием курсора ожидания.
    • Добавлено отображение сообщения при сохранении файлов PSD.
    [2.3.2]
    • Исправлена ​​проблема с диалоговым окном «Сохранить как»
    • Улучшено диалоговое окно параметров растеризации
    • Исправлено поведение при выборе инструмента
    • Исправлено поведение при выполнении меню
    [2.
    3.1]
    • Исправлена ​​ошибка в установщике (проблема с DLL для эскизов)
    • Переходы теперь можно указывать при составлении кисти
    • Исправлена ​​проблема с отображением размера кисти.
    [2.3.0]
    • Улучшенная обработка мультитач (Windows)
    • Исправлена ​​проблема с невозможностью рисования пальцем на сенсорном экране (Windows)
    • Улучшена производительность рисования кистью
    • Улучшенный инструмент перемещения
    • Улучшение отображения выбора
    [2.2.10]
    • В меню «Файл» добавлено «Сохранить как (указать дату)».
    [2.2.9]
    • Исправлена ​​ошибка настройки цвета края текста
    • Исправлена ​​ошибка обработки ластиком поверхностного пера
    • Добавлен параметр кисти, который может быть улучшен, если начало рисования кистью задерживается при использовании определенного графического планшета (установите флажок «Начинать кисть в момент обнаружения давления» в настройках среды кисти) (Windows)
    [2.
    2.8]
    • Исправлена ​​ошибка, из-за которой шрифт текста по умолчанию не сохранялся
    • Панель больше не сжимает окна при деформации слоя
    • Ускорение преобразования слоя
    • Исправлена ​​ошибка, из-за которой кнопка ластика на Surface Pen была недоступна (Windows)
    [2.2.7]
    • Исправлена ​​ошибка при слиянии слоев
    • Исправлена ​​ошибка, из-за которой рисование кистью выполнялось за пределами выбранного диапазона (macOS)
    [2.2.6]
    • Улучшено поведение при добавлении слоев
    • Изменена минимальная ширина окна управления кистью
    • Улучшена обработка завершения приложений
    • Исправлена ​​ошибка отображения значка шестеренки в окне слоя
    • Исправлена ​​ошибка настройки непрозрачности окна слоя
    [2.2.5]
    • Исправлена ​​проблема с процессом стирания с помощью кнопок на графическом планшете
    [2.2.4]
    • Теперь края текста можно раскрашивать.
    • Исправлена ​​ошибка инструмента градиента.
    • Максимальный размер кисти изменен на 2000 пикселей.
    • Исправлена ​​ошибка в ассоциации файлов. (макОС)
    [2.2.3]
    • Теперь края текста можно раскрашивать.
    • Исправлена ​​ошибка инструмента градиента.
    • Максимальный размер кисти изменен на 2000 пикселей.
    • Исправлена ​​ошибка в ассоциации файлов.(макОС)
    [2.2.2]
    • Исправлена ​​ошибка, не позволявшая использовать шрифты OpenType.
    • Исправлена ​​ошибка, когда размер указывался ниже десятичной точки при редактировании текстового слоя.
    • Исправлена ​​ошибка, из-за которой функция «Открыть как новый слой» была отключена.
    • Функция «Открыть как новый слой» теперь поддерживает файлы MDP.
    [2.2.1]
    • Исправлен сбой при выполнении нового вида на холсте.
    [2.2.0]
    • 8-битный слой может отображаться полутонами.
    • Добавлена ​​поддержка поворота дисплея во время мультитач (можно отключить в настройках среды).
    • Единицы измерения теперь можно указывать в диалоговом окне разрешения холста.
    • Теперь можно указать непрозрачность с помощью инструмента «Точечная кисть».
    • Улучшено отображение информации о пипетке.
    • Теперь вы можете выбрать API давления пера для использования.(Виндовс)
    • Добавлено «Edge Pen 2» (Edge Pen, указывающее ширину края в пикселях)
    • Добавлены «Вычесть» и «Исключить» в режим наложения слоя.
    • Теперь миниатюры отображаются при наведении курсора на значки папок слоев.
    • Изображение предварительного просмотра (содержимое папки) отображается в диалоговом окне отображения свойств папки слоя.
    • Теперь можно установить «Коррекцию давления» и «Стабилизацию» для каждой кисти.
    • «Кнопку Альпака» можно скрыть (из настроек среды).
    • Добавлена ​​функция публикации в «pixiv Sketch».
    [2.
    1.21]
    • Улучшена функция управления цветом.
    • Добавлен редактор сценариев Brush (меню Help).
    • Исправлена ​​ошибка обработки кисти.
    [2.1.20]
    [2.1.19]
    • Исправлена ​​ошибка с акварельной кромкой.
    [2.1.18]
    [2.1.14]
    • Исправлена ​​неисправность роликовой щетки.
    • Реализовано переворачивание папки по горизонтали/вертикали.
    [2.1.13]
    • Исправлена ​​ошибка фильтра Tonecurve.
    [2.1.12]
    [2.1.11]
    • Добавлен новый тип кисти «Микс».
    • Исправлена ​​ошибка.
    [2.1.10]
    • Добавлен фильтр размытия линз.
    • Реализована функция мультитач (планшет). (Виндовс)
    • Исправлена ​​ошибка.
    [2.1.9]
    • Исправлена ​​ошибка.
    • Улучшена обработка кисти.
    [2.1.8]
    • Добавлен фильтр японского рисунка.
    [2.1.7]
    • Исправлена ​​ошибка смешивания слоев (переход «Цвет»).
    [2.1.6]
    • Инструмент «Ведро» доработан (добавлена ​​опция «Допуск»).
    • Добавлен фильтр нерезкой маски.
    [2.1.5]
    • Добавлен фильтр размытия в движении.
    • Добавлен фильтр концентрированной линии.
    [2.1.4]
    • Исправлена ​​ошибка с окном выбора размера кисти.
    • Теперь при обрезке размера холста вы можете удалить или сохранить внешнюю часть холста.
    [2.1.3]
    • Добавлено окно выбора размера кисти.
      — Размер можно изменить правой кнопкой мыши.
    • Наименьший размер кисти теперь равен 0,1 пикселя.
    • Доступно сохранение настройки кисти при сохранении и чтении файла.
      — Вы можете настроить, щелкнув правой кнопкой мыши список кистей.
    • Улучшен список предустановленных кистей.
    • Исправлена ​​ошибка обработки отсечения.
    • Исправлен разрыв между курсором кисти и реальным рисунком при вращении.
    [2.1.2]
    [2.1.1]
    [2.1.0]
    • Добавлена ​​функция управления цветом.
      — Профиль RGB/CMYK можно указать в «Создать новое изображение».
      — Профиль можно применить из меню «Вид».
      — Предварительный просмотр вывода CMYK доступен при включении «Мягкой цветопробы CMYK».
      — цветовой профиль будет встроен в файл MDP.
      — теперь поддерживается чтение/запись профиля ICC с файлом PSD.
      — теперь поддерживается считывание профиля ICC с файлом JPEG/PNG.
    • Доступно создание файла PSD в формате CMYK.
      — Вы можете работать из меню «Файл» с включенным CMYK Soft Proof.
    • Добавлена ​​функция роликовой (ленточной) кисти.
    • В инструмент «Ведро» добавлена ​​опция «Заполнить пробелы».
    • Исправлено зависание программы при вставке нескольких слоев.
    [2.0.1]
    • Удалите 2.0.0 перед установкой 2.0.1. (Виндовс)
    • Добавлен файл, необходимый для компьютерной среды, которая не может запустить FireAlpaca. (Виндовс)
    • Исправлена ​​ошибка, приводившая к ошибке именования кистей по умолчанию. (Виндовс)
    • Улучшен процесс сохранения файла MDP.
    [2.0.0]
    • 64-битная версия доступна для Windows.
    • Доступен выбор нескольких слоев.
      — выберите несколько слоев, удерживая клавишу Shift и щелкая слои.
      — Инвертируйте выделение, удерживая нажатой клавишу Control и щелкая слой.
      — Добавлена ​​функция папки слоев для организации нескольких слоев.
    • Исправлена ​​ошибка фильтра Hue.
    • Предыдущие и последующие кадры в режиме луковой кожи можно отключить.
    • Повышена стабильность сохранения и чтения файла MDP.
    [1.9.1]
    • Функция кожицы лука была улучшена.
    [1.9.0]
    [1.8.11]
    • Исправлена ​​ошибка фильтра Hue.
    • Функция Маска/Трафарет улучшена.
    [1.8.10]
    • Добавлена ​​смесь «Разделить».
    • Исправлена ​​ошибка «Дублировать папку слоя».
    [1.8.9]
    • Исправлена ​​работа Навигатора.
    [1.8.8]
    • Повышена производительность кисти.
    • Небольшое исправление.
    [1.8.7]
    • Исправлена ​​работа Навигатора.
    [1.8.6]
    [1.8.5]
    • Повышение производительности.
    • Малый фиксированный.дед.
    [1.
    8.4]
    • Добавлена ​​кривая тона, работа канала, фильтр хроматических аберраций.
    [1.8.3]
    • Добавлена ​​функция слоя маски («Слой» > «Добавить маску (8 бит)»).
    • Добавлена ​​функция слоя трафарета («Слой» > «Добавить трафарет (8 бит)»).
    • Небольшое исправление.
    [1.8.2]
    [1.8.1]
    [1.8.0]
    • Потребление памяти уменьшилось.
    • Инструмент градиента был улучшен.
    • Текстовый инструмент был улучшен.
    [1.7.6]
    • Добавлен значок свойства слоя (значок шестеренки).
    [1.7.5]
    • Поддерживается ввод стилусом из TabletPC API (Surface, raytrektab и т. д.)
    • Улучшен выбор расширения/эрозии.
    [1.7.4]
    • Неисправность устранена.
    [1.7.3]
    • Исправление кисти (стабилизатор) было улучшено.
    • Исправлена ​​ошибка сценария кисти.
    [1.7.2]
    • Исправлена ​​работа Навигатора.
    [1.7.1]
    • Неисправность устранена.
    [1.6.4]
    • Улучшена производительность «Преобразования сетки».
    • Улучшено качество отображения операций «Преобразование» и «Преобразование сетки».
    • Поддержка ошибки планшетов HUION доступна в «Предпочтениях».
    • Предустановленная кисть обновлена.
    [1.6.3]
    • Добавлено преобразование сетки.
    • Неисправность устранена.
    [1.6.2]
    • Некоторые функции были улучшены.
    [1.6.1]
    • Неисправность устранена.
    [1.6.0]
    • Неисправность устранена.
    [1.5.23]
    • Неисправность устранена.
    [1.5.22]
    • Неисправность устранена.
    [1.5.21]
    • Добавлен параметр «Кисть».
    [1.5.20]
    • Неисправность устранена.
    [1.5.19]
    • Неисправность устранена.
    [1.5.18]
    • Неисправность устранена.
    [1.5.17]
    • Неисправность устранена.
    [1.5.16]
    • Неисправность устранена.
    [1.5.15]
    • Неисправность устранена.
    [1.5.14]
    • Неисправность устранена.
    [1.5.13]
    • Добавлена ​​акварельная кромка.
    [1.5.12]
    • Добавлена ​​новая функция.
    [1.5.11]
    • Неисправность устранена.
    [1.5.10]
    • Неисправность устранена.
    [1.5.9]
    • Неисправность устранена.
    [1.5.8]
    • Неисправность устранена.
    [1.5.7]
    • Изменен метод обозначения качества изображения при Преобразовании слоя (Ctrl+T):
      — Ближайший сосед (Создаст неровности)
      — Билинейный (Преобразует плавно)
      — Бикубический (Сохраняет резкость после многократного преобразования, но увеличивает нагрузка)
    • Исправлена ​​ошибка чтения PSD файла.
    • Повышена стабильность.
    [1.5.6]
    • Неисправность устранена.
    [1.5.5]
    • Добавлено справочное окно.
    • Добавлена ​​функция автоматического рисования активной кистью вдоль кривой привязки.
    • Добавлено больше фильтров с облаками и песком.
    • Исправлено несколько мелких ошибок.
    [1.5.4]
    • Неисправность устранена.
    • Добавлена ​​предустановленная кисть.
    [1.5.3]
    • Неисправность устранена.
    [1.5.2]
    • Неисправность устранена.
    [1.5.1]
    • Вы можете открыть веб-сайт AlpacaDouga при выводе слоев в последовательном порядке.
    • Изменена производительность меню выбора слоя с режимом Onion Skin.
    [1.5.0]
    • Добавлены узорчатая кисть и растровая кисть.
    • Доступно свободное преобразование в папку. *применимо к слоям 1, 8, 32 бит на пиксель.
    • Доступна регулировка перспективы в Free Transform.
    • Добавлен режим отображения Onionskin.
    • Добавлена ​​функция вывода PNG с порядковыми номерами слоев **в режиме луковицы.
    • Добавлена ​​функция автоматического воспроизведения слоя с режимом луковицы.
    • Изменена цветовая схема пользовательского интерфейса на синюю основу.
    • «Фильтр» перемещен в отдельное меню.
    • Доступна функция блокировки цветовой палитры.
    • Исправлено несколько ошибок.
    [1.4.1]
    • Повышена стабильность.
    • Исправлена ​​ошибка установщика в среде WindowsXP.
      — Отображение эскизов в формате MDP в среде WindowsXP не поддерживается.
    [1.4.1]
    • Добавлена ​​функция редактирования сочетания клавиш.
      — «Опция (индивидуальная) + клавиша» недоступна для версии для Mac.
    • Исправлена ​​ошибка навигации после поворота.
    • Улучшен статус перевода, кроме японского и английского.
    • Исправлена ​​ошибка прямой линии с помощью Brush Script.
    • Миниатюра файла будет доступна в проводнике (только для Windows).
    [1.4.0]
    • Добавлена ​​функция редактирования сочетания клавиш.
      — «Опция (индивидуальная) + клавиша» недоступна для версии для Mac.
    • Исправлена ​​ошибка навигации после поворота.
    • Улучшен статус перевода, кроме японского и английского.
    • Исправлена ​​ошибка прямой линии с помощью Brush Script.
    • Миниатюра файла будет доступна в проводнике (только для Windows).
    [1.3.0]
    • Настройка цвета фона доступна для каждого изображения.
    • Можно указать цвет фона.
    • История размеров изображения при создании нового документа будет сохранена.
    • Улучшен процесс сохранения файла в формате JPEG.
    • Параметры «Выбрать из центра» и «Сохранить пропорции» добавлены к инструментам «Выделение» и «Заливка».
    • Добавлены шаблоны для комикса при создании нового документа.
    • Можно добавить комический материал рамки.
    • Добавлен инструмент «Разделить кадр».
    [1.2.2]
    • Параметр «Появление/исчезновение» добавлен в функцию «Кисть (Перо)».
    • Исправлена ​​ошибка отмены выбора полигона правой кнопкой мыши.
    • Улучшено сохранение формата PNG.
    • Исправлена ​​ошибка диалога редактора кистей.
    [1.2.1]
    • В группу кистей добавлено больше функций.
    • Панель угла поворота навигатора может отображаться постоянно.(настройка в разделе «Настройки»)
    • Доступна автоматическая прокрутка списка кистей.
    • Исправлена ​​ошибка инструмента Fingertip.
    [1.2.0]
    • Теперь он совместим со сценарием кисти (сценарий управления кистью).
    • Добавлена ​​предустановленная кисть для скрипта кисти.
      — маркер, симметрия, аналоговое перо и т. д.
      — сценарий кисти достаточно гибкий, поэтому используйте его с умом.
    • Макс. Размер кисти увеличен до 1000 пикселей.
    • Управление кистями теперь отображает меню параметров.
    [1.1.17]
    • Неисправность устранена.
    [1.1.16]
    • Улучшено отображение слоев и списка кистей.
    • Слой можно отражать вертикально/горизонтально с помощью любого инструмента выбора, кроме прямоугольного.
    • Исправлена ​​ошибка обработки клавиатуры. (для Windows)
    • Исправлена ​​ошибка отображения при преобразовании фигуры.
    • Добавлена ​​панель угла поворота
    • .
    • Сетка на пиксель может быть отключена как опция.
    [1.1.15]
    • Кисть можно переключать перетаскиванием влево.
    • Палитру можно переключать перетаскиванием влево.
    • Улучшено управление кистями.
      *Цифровой ввод размера кисти включен.
    [1.1.14]
    • Добавлено еще 5 типов режима наложения слоев.
    • Теперь текстовый слой можно преобразовать в цветной.
    • Инструмент «Лассо» доступен для выбора на панели инструментов отдельно.
    [1.1.13]
    • Улучшено отображение холста при изменении слоя.
    • Тонкая настройка размера текста доступна с помощью кнопки.
    [1.1.12]
    • Добавлен шаблон размера открытки.
    • Исправлена ​​ошибка вывода в формат PSD (не удалось сохранить 1-битный слой).
    • Файл изображения можно перетащить в список слоев путем перетаскивания.
    • Добавлена ​​опция сглаживания при добавлении текстов.
    [1.1.11]
    • Инструмент «Пипетка» доступен с помощью правой кнопки (вы также можете вернуться к настройкам по умолчанию)
    [1.1.10]
    • В профессиональный режим добавлен 1-битный слой.
    • Добавлены шаблоны для наклеек LINE. *одинаковый размер, двойной размер, четверной размер
    • Исправлена ​​ошибка ярлыка выбора слоя.
    • Исправлена ​​ошибка текстового слоя.
    • Улучшена производительность «Сохранить как».
    [1.1.9]
    • Исправлена ​​ошибка обработки отсечения.
    • При чтении/сохранении файлов bmp/png будет использоваться формат
    • точек на дюйм.
    • Улучшена производительность функции «Сохранить как». (Виндовс)
    [1.1.8]
    • Добавлена ​​кисть для кончиков пальцев.
    • Исправлена ​​критическая ошибка в инструменте «Текст».
    • Криволинейная привязка была улучшена.
    [1.1.7]
    • Исправлена ​​ошибка, из-за которой выделенная область исчезала с некоторыми элементами управления при использовании Free Transform.
    • Обновлен параметр по умолчанию для инструмента «Перемещение».
    • Исправлена ​​ошибка сохранения состояния инструмента Move.
    [1.1.6]
    • Улучшен линейный фильтр вытяжки.
    • Исправлена ​​ошибка при использовании инструмента частичного перемещения.
    • Исправлен случайный сбой системы при использовании эллипсоидальных инструментов. * для Mac
    • Исправлена ​​ошибка при получении принтера. * для Windows
    • Среда разработки возвращается к Qt4.7.4. * для Windows
    [1.
    1.5]
    • Неисправность устранена.
    [1.1.4]
    • Добавлен фильтр извлечения линейки.
    • Опции доступны при растрировании изображения.
    • Доступен выбор слоя щелчком по изображению с помощью инструмента перемещения.
    • Исправлена ​​работа сочетания клавиш. * для Mac
    • Среда разработки вернулась к Qt4.7.4. * для Mac
    [1.1.3]
    • Неисправность устранена.
    [1.1.2]
    • Среда разработки обновлена. (Qt4.7.4 -> Qt5.3.0)
    • Предупреждение будет выдано при попытке сохранить файл со слоями в формате, который не поддерживает информацию о слоях.
    • При сохранении формата PNG можно выбрать прозрачный PNG или 24-битный PNG. (используется для определения фоновым режимом)
    • Окно изменения размера стало проще в обращении. (версия для Mac)
    • Настройка привязки может быть сохранена/перезагружена.
    • Он будет сохранен в файле MDP.
    • Перекрестная привязка не может быть сохранена.
    • Числовой ввод для настройки размера кисти доступен в диалоговом окне «Редактировать кисть».
    [1.0,52]
    • Добавлена ​​возможность указания размера холста при создании нового холста.
      Вы можете выбрать от A2 до A6 и от B2 до B6.
    • В режим кисти добавлен прозрачный режим.
    • Передний план и прозрачная кисть могут переключаться в цветовом окне.
    • Вы можете удалять рисунки с выбранной формой кисти, как с помощью ластика.
    • Вы можете временно переключиться в режим прозрачной кисти, нажав «Z», как это было раньше.
    [1.0.51]
    • Неисправность оригинальной кисти, которую нельзя использовать после удаления дублированной кисти, исправлена.
    [1.0.50]
    • Добавлена ​​функция привязки Кривая/эллипс/концентрические окружности.
    [1.0.49]
    • Улучшена функция папки слоев.
    [1.0.48]
    • Добавлена ​​функция папки слоев.
    [1.0,47]
    • Улучшено качество кисти Blur.
    • Файл FireAlpaca можно открыть, щелкнув его в среде Windows. (Виндовс)
    • Улучшена производительность отображения масштаба с помощью трекпада. (Мак)
    [1.0.46]
    • Добавлена ​​функция рассеивающей кисти «Акварель».
    [1.0.45]
    • Сантиметры и дюймы доступны при установке ширины и высоты при создании нового документа.
    [1.0.44]
    • Примените свободное преобразование, переместив вершину, удерживая нажатой клавишу Ctrl.
    [1.0.43]
    • Добавлена ​​функция рассеивающей кисти.
    • Исправлены ошибки текстового слоя.
    [1.0.42]
    • Добавлена ​​функция ввода текста.
    [1.0.41]
    • [Windows] — всплывающее меню не будет отображаться при нажатии клавиши «Пробел» при нажатой клавише [Windows] Alt.
    [1.0.40]
    • Исправлены неисправности инструментов Bucket и MagicWand.
    [1.0.39]
    • Добавлены мягкие края и ластик.
    [1.0.38]
    • Исправлены различные неисправности.
    [1.0.37]
    • Исправлена ​​ошибка функции Undo/Redo.
    [1.0.36]
    • Добавлена ​​растровая кисть.
    • Выберите PNG-изображение для вашей кисти на втором значке слева в окне кисти.
    • Вы также можете добавить изображение PNG, перетащив его в окно кисти.
    • Исправлена ​​ошибка отображения меню в Mountain Lion.
    [1.0.35]
    • Улучшено качество аэрографа и акварели.
    • Исправлены различные неисправности.
    [1.0.34]
    • Мягкий край изменен на версию [1.0,30].
    [1.0.33]
    • Исправлена ​​работа полосы прокрутки Цветовой палитры.
    • Исправлена ​​ошибка переключения языка в операционной системе с английским режимом.
    [1.0.32]
    • Неисправность, возникавшая в версии 1. 0.31, была исправлена.
      — Исправлено некорректное отображение окна 8-битного слоя.
      — Исправлена ​​ошибка обновления строки состояния.
      — Исправлена ​​ошибка пипетки с режимом круга оттенка.
      — Неисправность отображения имени слоя при вводе-из/выводе-в формате PSD.
    [1.0.31]
    • Круг оттенка доступен при выборе цвета.
    • Улучшен мазок кисти после настройки уровня резкости.
    • Мягкий край, созданный акварельной кистью, теперь можно обрезать.
    [1.0.30]
    • После закрытия программы со свернутыми окнами исправлено некорректное функционирование окон при следующем запуске.
    • Стабильность могла быть улучшена.
    [1.0.29]
    • Исправлена ​​ошибка обновления навигатора после изменения непрозрачности слоя.
    • Исправлена ​​ошибка отображения навигатора.
    [1.0.28]
    • Добавлено больше акварельных кистей.
    • Теперь можно отображать размер кисти.
    [1.0.27]
    • Исправлена ​​ошибка печати с недоступным принтером.
    • Улучшено удобство использования окна слоев.
    [1.0.26]
    • (Mac) Повышена стабильность.
    [1.0.25]
    • Координаты мыши теперь доступны в Координатах кисти.
    • Улучшены функции печати.
    • Диалоговое окно и его удобство использования были улучшены.
    [1.0.24]
    • Добавлены функции печати.
    • Доступно отключение OpenMP. (из настройки среды)
      — Отключение OpenMP замедляет скорость обработки. (например, обновление экрана, применение размытия по Гауссу и т. д.)
      — Если вы часто получаете принудительное завершение, отключение OpenMP может помочь решить проблему.
    [1.0.23]
    • Добавлена ​​кисть размытия
    [1.0.21]
    • Добавлен режим наложения слоев. (Оверлей/Экран)
    [1.0,20]
    • Теперь доступно чтение изображения GIF.
    • Исправлена ​​ошибка вращения 8-битного слоя.
    [1.0.19]
    • Добавлен [Профессиональный режим]. (переключение из настройки среды)
      — 8-битный слой можно добавить в профессиональном режиме.
      — 8-битный слой обрабатывает только непрозрачность, поэтому он легкий и подходит для линейных рисунков.
      — Цветной слой и 8-битный слой можно переключать.
    • Строка состояния может быть скрыта.
    • Исправлена ​​неисправность буфера обмена.
    • Окно слоев можно прокручивать вверх и вниз с помощью колеса прокрутки мыши.
    • Окно кисти можно прокручивать вверх и вниз с помощью колеса прокрутки мыши.
    [1.0.18]
    • Повышена стабильность.
    [1.0.17]
    • Исправлена ​​ошибка ярлыка.
    • (Mac) Леопард(10.5) Поддержка.
    [1.0.16]
    • Повышена стабильность.
    [1.0.15]
    • Теперь программа доступна на 9 языках.
    • 9 языков: английский, японский, китайский (упрощенный, традиционный),
      корейский, португальский, испанский, немецкий, французский, русский
    • Исправлена ​​ошибка выделения прямоугольника со скругленными углами.
    [1.0.14]
    • Исправлена ​​ошибка считывания изображения.
    [1.0.13]
    • Повышена стабильность.
    [1.0.12]
    • Добавлена ​​функция отчета о сбое.
    [1.0.11]
    • (Windows) Исправлена ​​ошибка формата PSD.
    [1.0.10]
    • Исправлена ​​ошибка ярлыка.
    [1.0.9]
    • «Имя слоя формата ShiftJIS» доступно в формате PSD.
    • В функцию «Плавное перетаскивание» добавлен параметр. (Настройка среды)
    [1.0.8]
    • Добавлена ​​функция цветовой палитры.
    [1.0.7]
    • (Mac) Исправлена ​​ошибка управления мышью на панели инструментов.
    [1.0.6]
    • (Windows) Исправлена ​​ошибка с файлом jpeg.
    • (Mac) Исправлено отображение меню.
    [1.0,5]
    • Мы добавили предупреждающее сообщение, которое будет появляться, если вам не удается сохранить изображение.
    • Исправлено несколько неисправностей.
    [1.0.4]
    • Исправлена ​​ошибка в меню.
    [1.0.3]
    • Исправлена ​​ошибка диалогового окна разрешения.
    • Стала доступна опция переключения языка (на японский).
    [1.0.2]
    • Стали доступны инструменты расширения/сжатия выбранной области.
    • Исправлено несколько неисправностей.
    [1.0.0]

    Мелочи, рекорды и цифры, которые вы должны знать

    С момента своего создания в 2014 году Индийская Суперлига (ISL) была одним из столпов индийского футбола.

    С каждым сезоном у ISL были свои знаковые моменты, которые обогащали его историю. Статистика и записи неизменно играли в этом огромную роль.

    Оглядываясь назад, вот некоторые из статистических данных и рекордов ISL, которые должен знать каждый индийский футбольный фанат.

    Самая успешная команда ISL

    ATK , с тремя титулами ISL, в настоящее время является самой успешной командой ISL всех времен. Команда из Калькутты выиграла титул в своем первом сезоне в 2014 году, а затем одержала победы в 2016 году и в кампании 2019-20.

    Испанец Антонио Лопес Хабас руководил командой во время их побед на ISL в 2014 и 2019-20 годах, что сделало его единственным главным тренером, выигравшим несколько титулов ISL, причем с одной и той же командой.

    Chennaiyin FC был двукратным чемпионом, завоевав высшие награды в 2015 и 2017-18 годах. Бенгалуру выиграл титул в сезоне 2018-19.

    Первый бомбардир ISL

    Эфиопский нападающий Фикру Теферра навсегда останется в статистике и книгах рекордов ISL как первый бомбардир в истории ISL. Играя за ATK против Mumbai City FC в первом матче ISL на стадионе Солт-Лейк-Сити в Калькутте 12 октября 2014 года, Фикру забил гол на 27-й минуте.АТК выиграл матч со счетом 3:0.

    Балвант Сингх стал первым бомбардиром Индии в ISL после того, как забил гол за «Ченнайин» на 31-й минуте во время победы Марины Мачанс со счетом 2: 1 над FC Goa на Fatorda 15 октября 2014 года.

    Бразильский нападающий ФК «Мумбаи Сити» Андре Мориц сделал первых в истории ISL хет-триков в первом сезоне во время победы над «Пуной Сити» со счетом 5:0 18 октября 2014 года.

    Лучший бомбардир ISL

    Бывший нападающий ФК Гоа Ферран Короминас возглавляет статистику ISL по количеству бомбардиров с 48 голами в 57 матчах ISL. Сунил Чхетри из «Бенгалуру» занимает второе место с 47 голами в 94 матчах.

    Чхетри также является лучшим бомбардиром Индии в ISL, за ним следует Джедже Лалпехлуа, который играл в ISL 2020-21 за Восточную Бенгалию.

    Самый быстрый бомбардир ISL

    Самый быстрый гол ISL забил нападающий ATK Mohun Bagan Дэвид Уильямс, который всего за 12 секунд забил гол в ворота Хайдарабада в матче ISL 2021-22 5 января 2022 года.

    Уильямс побил рекорд бывшего нападающего ФК «Джамшедпур» Джерри Мавимингтанги по результативности за 23 секунды в матче против «Керала Бластерс» на ISL 2017-18.

    Самый молодой бомбардир ISL

    Вингер ATK Комал Татал является рекордсменом среди самых молодых бомбардиров ISL .

    Юноша, которому тогда было 18 лет, 1 месяц и 13 дней, забил 31 октября 2018 года в матче ISL 2018-19 ISL со счетом 2:1 против «Бенгалуру», побив предыдущий рекорд Джерри Лалринсуала.

    Самый большой выигрыш в ISL

    ФК Гоа зафиксировал самый большой выигрыш в в ISL до настоящего времени, когда они разгромили Мумбаи Сити 7-0 на Fatorda в ISL 2015.Матч был сыгран 17 ноября 2015 года.

    Дуду Омагбеми и Тонгкхосим Хаокип сделали по хет-трику, а бразилец Рейнальдо забил еще один гол за «Гуар».

    Самый результативный матч в ISL

    самый результативный матч в истории ISL – это матч с 11 голами между East Bengal и Odisha FC в ISL 2020-21. Поскольку обе команды томились в нижней части таблицы и направлялись к финальному матчу своей кампании, гордость была единственным стимулом, который предлагался в матче.

    Восточная Бенгалия в первом тайме повела 2:1, но во втором тайме «Одиша» нанесла ответный удар, вырвавшись вперед 6:3. «Красно-золотые» забили два поздних гола и сделали счет 6:5, но было слишком поздно, чтобы не оказаться на неправильном конце таблицы.

    За «Одишу» Пол Рамфангзаува и Джерри Мавихмингтанга забили по дублю, а за «Восточную Бенгалию» два гола забил валлиец Аарон Амади-Холлоуэй.

    Самая длинная беспроигрышная серия в ISL

    ФК Гоа является рекордсменом по самой длинной беспроигрышной серии в в ISL .Гаурам удалось прервать серию в ISL 2020-21 .

    После неудачного начала своей кампании ФК Гоа начал свою серию с победы со счетом 2:1 над ФК Джамшедпур и провел 13 матчей без поражений, чтобы выйти в плей-офф.

    В полуфинале «Гоа» обыграл «Мумбаи Сити» со счетом 2:2 в первом матче и свел «Айлендерс» со счетом 0:0 во втором. К сожалению, их борьба за титул закончилась после поражения в серии пенальти 6-5.

    Однако правила ФИФА не классифицируют матч на выбывание, в котором решается серия пенальти, как поражение выбывшей команды.Вместо этого они называются розыгрышами.

    Таким образом, беспроигрышная серия ФК «Гоа» в ISL 2020-21 составляет 15 — самая длинная серия за один сезон ISL.

    Bengaluru FC имеет самую длинную победную серию в ISL . «Синие» выиграли шесть на рыси на пути к титулу во время ISL 2018-19.

    Самая длинная безвыигрышная серия в ISL

    Хайдарабад ФК провел 14 матчей без побед в своей первой кампании ISL в сезоне 2019-20, что делает его самой продолжительной безвыигрышной серией среди всех команд ISL на сегодняшний день.

    Самая длинная серия потерь , однако, находится под именем Delhi Dynamos ’. «Львы» проиграли шесть подряд в сезоне 2017/18.

    Самый длинный гол в истории ISL

    Бывший полузащитник футбольного клуба «Ченнайин» Рафаэль Кривелларо является рекордсменом по самому длинному голу в истории ISL () – 55 ярдов.

    В матче между «Ченнайином» и «Норт-Ист Юнайтед» на ISL 2019-20 Рафаэль Кривелларо подобрал мяч у средней линии и пропустил его почти с 55 ярдов.Дальний рейнджер бразильца поймал вратаря NorthEast Субхасиша Роя Чоудхури со своей линии и оказался в конце ворот.

    Команда, забившая больше всего голов в ISL

    FC Goa стала командой , забившей больше всего голов в истории соревнований. После завершения ISL 2020-21 гауры забили 238 голов в 130 матчах.

    Chennaiyin FC занял второе место в таблице лидеров с 182 голами в 127 матчах.

    .
Comments